• Q : Introduction to polynucleotide codons....
    Biology :

    Once it was found out that codons consisted of three-nucleotide sequences, the specificity of each and every codon could be determined.

  • Q : Trinucleotides and protein sequence....
    Biology :

    If the sequences are read in dissimilar reading frames, explain how does this influence the resulting protein sequence?

  • Q : Rflp-vntr-snp-definitions and use....
    Biology :

    Describe the terms RFLPs, VNTRs, and SNPs? What is the relationship among these? Explain how do we use this technology to, for example, recognize paternity?

  • Q : Chromosomal inversions-deletion with human disorders....
    Biology :

    Name a human congenital disorder which has been attributed to a chromosomal deletion. Explain how common is the disorder? Which human chromosome has suffered a deletion in the disorder?

  • Q : Concepts of homologous chromosome....
    Biology :

    Describe the concepts of homologous chromosome - diploid and haploid. What features are shared between the two homologous chromosomes?

  • Q : G-protein linked receptors....
    Biology :

    G-protein linked receptors activate the G proteins by decreasing the strength of GDP binding. This outcomes in rapid dissociation of bound GDP, which is then replaced by the GTP, which is present in

  • Q : Role of double helix....
    Biology :

    Explain the role of double helix in complimentary base pairing in DNA replication. What does it signify when we state that the two strands of DNA in the double helix are anti-parallel?

  • Q : Basics of dna sequence....
    Biology :

    By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given questions. a) Write down the mRNA sequence. b) Write down the sequence of the start codon.

  • Q : Development of embryo....
    Biology :

    Write down the processes and phases of human embryogenesis? Explain how does a fetus develop from a one-cell fertilized egg?

  • Q : Describing chromosomes breaks....
    Biology :

    Illustrate, define and describe the single break chromosomes: a) One arm of one chromosome. b) One arm of two chromosomes.

  • Q : Genes in regulation mammalian biological clock....
    Biology :

    What genes are comprised with the regulation mammalian "biological clock" causing it to maintain a consistent 24 hour cycle? Please explain the possible pathways comprised in this phenomenon?

  • Q : Human genome level....
    Biology :

    I understand the utilization of processed food products needed some adaptation on the human genome level. Animals don't consume sterile alcoholic beverages and milk is only consumed by the young.

  • Q : Dna sequencing and technology....
    Biology :

    Explain DNA sequencing with reference to the cloning of a DNA fragment in bacteriophages M13 based cloning vector.

  • Q : Promoters for mrna....
    Biology :

    The promoters for mRNA encoding early proteins in viruses such as T4 have a different sequence than the promoters for mRNA encoding late proteins in the same virus.

  • Q : Constructing cdna libraries....
    Biology :

    Whenever constructing cDNA libraries it is much significant to copy the whole of an mRNA into cDNA. One way to try and make sure that the 5' end of an mRNA is represented in a cDNA copy is to use "c

  • Q : Components of an operon....
    Biology :

    Write down the components of an operon? What significant regulator is not part of the actual operon? Know how operons are classified and how each kind works (Inducible, Repressible, Positive and Neg

  • Q : Promoters for mrna encoding....
    Biology :

    The promoters for mRNA encoding early proteins in viruses similar to T4 have a dissimilar sequence than the promoters for mRNA encoding late proteins in the same virus.

  • Q : Chromatin and dna modifications versus rnai....
    Biology :

    Compare and contrast the repressive effects of chromatin and DNA modifications with the repressive effects of RNAi. Comprising: a) A fundamental overview of RISC and RITS repression.

  • Q : Disadvantage of random transgene integration....
    Biology :

    Write down the advantages and drawbacks of using random transgenic integration compared with the homologous recombination to introduce DNA into the genome?

  • Q : Enzyme induction-inducible enzymes....
    Biology :

    What are the merits to a microbe as an effect of such (inducible) an arrangement of genes, and what is this arrangement termed?

  • Q : Analysis of mitochondrial dna....
    Biology :

    Give two key insights into the evolutionary history of Neandertals which have been derived from the analysis of mitochondrial DNA (mtDNA). In what manners might the use of mtDNA be misleading or lim

  • Q : Dna transcription and replication....
    Biology :

    Explain how does transcription distinct from DNA replication? How is it similar? Describe the role of complementary base-pairing in each?

  • Q : Translocation of the proteins....
    Biology :

    By using the three criteria outlined in the problem decide whether the experimental outcomes in the presence of microsomes (lanes 5 to 8) point out that the protein is translocated across microsomal

  • Q : Galactose represser protein....
    Biology :

    The galactose represser protein from E. coli has a pI of around 5.9. While purification protocols were being designed, and it was found to bind to a Mono-S column at pH values of 7 and below.

  • Q : Function of stress proteins....
    Biology :

    Write down the function of "stress" proteins under heat shock conditions and explain how is this associated to their function under normal conditions? I describe the method underlying their actions

©TutorsGlobe All rights reserved 2022-2023.