Start Discovering Solved Questions and Your Course Assignments
TextBooks Included
Active Tutors
Asked Questions
Answered Questions
They are slow moving and so have no way of escaping from predators when on the ground. Not to mention the energy they expire to break from their normally sedentary lifestyle.
As far as I know and could understand from reading about HIV, T helper cell is one of the main reasons to develop AIDS in patients infected with HIV virus, that because the absence of helper T cell
Where would I find an up to date (last 6-7 years max) review on B cells? I've tried searching through pubmed with filters, cochrane library, medline and various other resources including searching o
I found this article on estimating body time using molecular timetable of 168 genes. researchers looked at gene expressions and plotted them to 24 hour cosines curve with some pretty spectacular re
Peach, pear, apple, cherry, and many other fruit trees seem to have flowers comprised of five petals.
It's my understanding that various hazards can damage the DNA in our cells, causing mutations. But whenever I picture this, I see the damage being done to one of our tissues (for example, our lungs
Is it possible to use a biologically active Telemorease Elongation Reverse Transcriptase (TERT) in the place of the Reverse Transcriptase (RT) for quantitative Reverse Transcriptase pcr (qRT-pcr)
I'm reading this article on blood sugar and circadian rhythms and the following question popped into my head: a lot of articles mention various diurnal or circadian rhythmicity of biological process
I have always thought darker colors absorb more heat from the sun, so if you are wearing a white T-shirt you will be cooler under sun than wearing a darker T-shirt, or a black piece of steel will be
Industrial melanism refers to the dark pigmentation that evolved in some insects giving them protective coloration on vegetation darkened by soot in heavily industrialized areas prior to air polluti
what does a postive reaction to benedicts solution indicate about the solution you are testing? what change do you expect to see if a solution has a positive reaction to the benedicts solution?
Differentiate between the processes of resolution and regeneration what factor determine which of these processes will occur following an injury?
What would a gram positive bacteria look like if you forgot the alcohol step during the Gram stain procedure? Why?
State five different between nonsteroidal anti inflammatory druges (NSAID)AND glucocorticoids or steroidal anti inflammatory?
How is the pH scale used around your house
What are the three modifications made to pre-mRNA molecules before they become mature mRNAs, are transported from the nucleus to the cytoplasm, and become ready to be used in protein synthesis?
In the human gene for the beta chain of hemoglobin, the oxygen-carrying protein in the red blood cells, the first 30 nucleotides in the protein-coding region are shown here: 3' TACCACGTGGACTGAGGACT
What is the epithelialmesenchymal transition
In general terms, what is the normal cellular function of RAS How is RAS activity commonly disrupted in cancer cells?
State two ways in which the specificity of CDK2 is controlled under normal circumstances.
Two proteins (X and Y) differ significantly in their pI values derived based on their amino acid sequence. Protein X has a pI of 8 and protein Y has a pI of 4.
Name two ways that bacteria undergo genetic recombination.
Describe each of the named biochemical operations in terms of the biochemical transformation involved, the reaction environment used, and the bioreactor configuration employed.
What is the role of eIF4E? How is eIF4E regulated?
MicroRNA 172 (miR172) targets the AP2 repressor of flowering in Arabidopsis thaliana. Describe how and why flowering time would be affected in the following experiments: miR172 is over-expressed