--%>

Write the mrna that would be transcribed


Problem: Here is part of a gene:

3'GTAACCGTATTGCAGCTATTAGCAGCCATG5'

5'CATTGGCATAACGTCGATAATCGTCGGTAC3'

If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from this section of the gene:

Request for Solution File

Ask an Expert for Answer!!
Biology: Write the mrna that would be transcribed
Reference No:- TGS03281654

Expected delivery within 24 Hours