Write the corresponding amino acid sequences that result


Which DNA sequence will encode for at least five amino acids? Change three different bases separately (either by addition or deletion) and write the corresponding amino acid sequences that result from these modifications just a detailed answer with in-text .

 

Solution Preview :

Prepared by a verified Expert
Science: Write the corresponding amino acid sequences that result
Reference No:- TGS01034276

Now Priced at $14 (50% Discount)

The DNA sequence which would encode for at least five amino acid polypeptide can be given as …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

Recommended (94%)

Rated (4.6/5)