Why is the use of temperature-stable dna polymerase, Biology

Why is the use of temperature-stable dna polymerase

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

View Complete Question

Request for Solution File

Ask an Expert for Answer!!

Biology: Why is the use of temperature-stable dna polymerase

Reference No:- TGS028336

Expected delivery within 24 Hours

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Recent Questions Asked Biology

Q : World wide operation of altria

What is your impression of the world wide operation of Altria?

Q : Assess the policy and strategy of shell service

Assess the policy and strategy of Shell Services in deciding to implement its own quality framework rather than using an existing model.

Q : Estimating the break-even point

Susan Meyer, owner/manager of Meyer's Motor Court in Key West, is considering outsourcing the daily room cleanup for her motel to Duffy's Maid Service. Susan rents an averate of 50 rooms for each of the 365 nights.

Q : Develop a proposed system for evaluating

Develop a proposed system for evaluating (measuring) and reporting the success of the company in achieving improved sustainability for the case. please lead me about that problem

Q : Why is the use of temperature-stable dna polymerase

Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

Q : Calculate the weighted mean of the probability distribution

In answering the following questions, it is given that the potential investment has the following range of possible outcomes and probabilities: 10% probability of a -20% return, 40% probability of a 15% return, 40% probability of a 25% return, and a

Q : Exercise to brainstorm

Identify their major cultural conflicts and challenges. Keep in mind that these are merely possibilities. We are using this exercise to brainstorm and work through ways that people may or may not interact and communicate.

Q : Compute cash flows if discount rates are given

the appropriate discount rates are 10 percent for the cash flows, and 7 percent for the debt. You currently own 10 percent of the stock. How much are your cash flows today?

Q : Is this a strand of dna or rna

If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

1955448

Questions
Asked

3,689

Active Tutors

1460254

Questions
Answered

Start Excelling in your courses, Ask a tutor for help and get answers for your problems !!

ask Question

Request for Solution File

Ask an Expert for Answer!!

Biology: Why is the use of temperature-stable dna polymerase

Reference No:- TGS028336

Have a Question? (oR Write a Review)

Recent Questions Asked Biology

Q : World wide operation of altria

Q : Assess the policy and strategy of shell service

Q : Estimating the break-even point

Q : Develop a proposed system for evaluating

Q : Why is the use of temperature-stable dna polymerase

Q : Calculate the weighted mean of the probability distribution

Q : Exercise to brainstorm

Q : Compute cash flows if discount rates are given

Q : Is this a strand of dna or rna

Patient noticed that his skin is redder than normal

What if patient has excessive dryness of the skin

How interconnected health technology really is

Male in hematology clinic with signs of progressive fatigue

Patient complains of diaphoresis, fatigue, abdominal pain

Patient been getting chest pains at weird times

Neurological nurse cares for clients having seizure disorder

Request for Solution File

Ask an Expert for Answer!!

Biology: Why is the use of temperature-stable dna polymerase

Reference No:- TGS028336

Recent Questions Asked Biology

Q : World wide operation of altria

Q : Assess the policy and strategy of shell service

Q : Estimating the break-even point

Q : Develop a proposed system for evaluating

Q : Why is the use of temperature-stable dna polymerase

Q : Calculate the weighted mean of the probability distribution

Q : Exercise to brainstorm

Q : Compute cash flows if discount rates are given

Q : Is this a strand of dna or rna

Asked Questions