--%>

While primers are usually 20 nucleotides long please make


What to do - Given the following piece of double stranded DNA (the two strands below bind together to form a piece of double stranded DNA) design two primers that will amplify the largest piece of DNA possible. 

  • While primers are usually ~20 nucleotides long, please make yours 9 nucleotides long for simplicity.
  • The size of your PCR product is roughly the distance between your two primers. See at the bottom of this question for a hint on how to calculate it. 
  • Remember direction is important! You should indicate on your primer sequence which is the 3' end and which is the 5' end.

5' - AATGTACCGCGTCTAGGCTGCTGATGCTTAGTCCCCCGATGATCGTGTGAAAAAGTAATCGTGCTGA

3' - TTACATGGCGCAGATCCGACGACTACGAATCAGGGGGCTACTAGCACACTTTTTCATTAGCACGACT

Hint: you need to find primers that amplify the largest piece of DNA possible. You can work out the length of your DNA fragment like this.

Highlight where your primers would bind on the DNA strands. In this example I have designed primers that would bind where the sequence is underlined. 

5' - XXXXXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXXXXXXXX

I'm going to replace the underlines with P (for primer) just so you can keep track of where it is.

5' - PPPPXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPPXXX

Now if I've designed my primers correctly and amplify this sequence then I should get a fragment that looks like this 

5' - PPPPXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPP

Notice only the area under the primer and between the two primers is replicated. Your job is to find the largest fragment you can replicate.

Solution Preview :

Prepared by a verified Expert
Biology: While primers are usually 20 nucleotides long please make
Reference No:- TGS02912443

Now Priced at $10 (50% Discount)

Recommended (91%)

Rated (4.3/5)