--%>

What binds to the operator of the lac operon


Problem:

Question 1:What binds to the operator of the lac operon?

Question 2: Tryptophan binds to the:

a) operator

b) promoter

c) RNA polymerase

d) trp genes

e) trp repressor.

Question 3: In the presence of tryptophan, transcription of the trp operon is on.

a) True

b) False

Question 4: The lac operon is expressed when:

a) glucose is high and lactose is present

b) glucose is high and lactose is absent

c) glucose is low and lactose is present

d) glucose is low and lactose is absent

e) glucose is low, regardless of the presence or absence of lactose

 

Question 5: When in a complex with ________, the CAP protein binds to the CAP site and ________ the expression of the lac operon.

a)      glucose ; switches on

b)      glucose ; switches off

c)       lactose ; switches on

d)      cAMP ; switches on

e)      cAMP ; switches off

Question 6: In the absence of lactose, the lac repressor :

a)      can bind to the operator  

b)      cannot bind to the operator

Question 7: In the absence of tryptophan, the trp repressor:

a)      can bind to the operator      

b)      cannot bind to the operator

 

Question 8:  A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein?

a)      nonsense mutation

b)      missense mutation

c)       silent mutation

d)      sense mutation

e)      none of the above

Question 9: What type of gene mutation occurred to produce the following protein sequence?

The protein sequences written below are written using the one letter abbreviations for amino acids.Each letter represents a particular amino acid.

Normal: JAYBIRDCATPAW

Mutated: JAYBIRDBATPAW

a)      nonsense

b)      missense

c)       silent

d)      sense

e)      frameshift

 

Question 10:  Based on the gene and protein sequences that follow, what type of mutation has occurred?

Normal gene: ATGGCCGGCCCGAAAGAGACC

Mutated gene: ATGGCCGGCACCGAAAGAGACC

Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr

Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

a)      nonsense

b)      missense

c)       silent

d)      sense

e)      frameshift

Give reasoning with your answer.

Request for Solution File

Ask an Expert for Answer!!
Biology: What binds to the operator of the lac operon
Reference No:- TGS0883038

Expected delivery within 24 Hours