Using the base pairing of rna to dna the genetic code


Using the base pairing of rna to dna, the genetic code tablerelating to amino acids to mRNA codons, and the one letterabbreviations for the amino acids, decode the following geneticmessage? m RNA is to be transcribed from the entire underlinedsequence.Remember that mRNA usesU in place of T and proeinsynthesisbegins with AUG.

CTGACGTATGGCTAACTATTGTCATATATTGGACCGGGAGAACCGTGCGACCGAAATGGCGACCCATGTGGAACGGTATTGGGAATATTGTAATAGCGTGTA
GACTGCATACCGATTGATAACAGTATATAACCTGGCCCTCTTGGCACGCTGGCTTTACCGCTGGGTACACCTTGCCATAACCCTTAATAACATTATCGCACAT-  
mRNA?
protein?
The message??

Request for Solution File

Ask an Expert for Answer!!
Biology: Using the base pairing of rna to dna the genetic code
Reference No:- TGS0802525

Expected delivery within 24 Hours