--%>

This gene is transcribed from left to right and


This gene is transcribed from left to right, and transcription begins at the first capital letter.

5'-agcaacctgAAACAGACACCATGGTGCACCTGACTCCTGAG

3'-tcgttggag TTTGTATGTGGTACCACGTGGACTGAGGACTC

Write the base sequence of the RNA (beginning with 5' end at left of page) that is transcribed from this region of the gene.

Solution Preview :

Prepared by a verified Expert
Biology: This gene is transcribed from left to right and
Reference No:- TGS02497355

Now Priced at $10 (50% Discount)

Recommended (93%)

Rated (4.5/5)