The two sequences below represent a normal and a mutated, Biology

+44 141 628 6080
[email protected]

The two sequences below represent a normal and a mutated

The two sequences below represent a normal and a mutated form ofmRNA. Which of the following statements best describes the type of mutation observed?

Normal 5' AUGCCAGCCAGCCCUUCCAGA 3'
Abnormal 5' AUGCCAGCCAGCCCUUCUAGA 3'

a) Point , Silent
b) Point , Missense
c) Point, Nonsense
d) Frame-shift , Insertion
e) Frame-shift, Deletion

Request for Solution File

Ask an Expert for Answer!!

Biology: The two sequences below represent a normal and a mutated

Reference No:- TGS0798023

Expected delivery within 24 Hours

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Asked Questions

Client develops a deficiency of antidiuretic hormone

After a head injury, a client develops a deficiency of antidiuretic hormone (ADH). What should the nurse consider before assessing the patient about

What when a patients health information may be shared

Question: Discuss when a patient's health information may be shared without written consent.

How you improve the prognosis toward integrity

In working backward from death to birth, responses to death vary with the age, circumstances of death, beliefs about death and the afterlife, social connection

Review a complimentary and alternative therapy

Choose a Complimentary and Alternative Therapy (i.e. Exercise Therapy) that would be beneficial for the treatment of major depressive disorder.

Treatment of child with acute upper respiratory infection

How will you incorporate the family's beliefs into the treatment of a child with an acute upper respiratory infection? With leukemia?

Mention the health promotion intervention for patient

Mention the health promotion intervention for this patient. What did you learn from this week's clinical experience that can beneficial for you as an advanced

Describe four prevention essential health benefits for women

Name and discuss four prevention essential health benefits for women that must be covered under the Affordable Care Act.

Request for Solution File

Ask an Expert for Answer!!

Biology: The two sequences below represent a normal and a mutated

Reference No:- TGS0798023

Have a Question? (oR Write a Review)

Recent Questions Asked Biology

Q : What is the ploidy of the gametophyte and the sporophyte

Q : What are the genotypes of the parents if a colour blind man

Q : A woman who is colour blind and has bractyldactly marries

Q : Is hairy pinna a sex linked disease if a man has hairy

Q : The two sequences below represent a normal and a mutated

Q : In fruit flies the gene y for yellow body is sex-linked

Q : In drosophila the gene vg for vestigial wing is a

Q : In fruit flies the gene b for black body is recessive to

Q : Double-stranded dna is a cylinder that is 20a wide and 34a