--%>

The first pcr primer shows a mismatch


A frequent use of nucleotide-nucleotide BLAST is to check oligonucleotides for hybridization or PCR. The goal most people have when doing this is to make sure that the primer will give a unique product from the target genome or cDNA population. Because BLAST is local and searches both strands, one can simply concatenate a pair of +/- strand primers and use them in a single search (10 points total).

Combine the following pair of candidate PCR primers in a nucleotide-nucleotide search against the default nucleotide database and identify the gene amplified (3 points). 

1. GTCAAGTGGCAACTCCGTCAG 

2. TTGAGAGATGGATTGTTGCGC (TC)


Now try these modified primers. There is one mismatch in each near the middle. 

1a. GTCAAGTGGCTACTCCGTCAG

2a. TTGAGAGATGTATTGTTGCGC (TC)

Do you find the original hits again? Are they still among the best hits? Can you devise a modification in the search strategy that will make them the best hits again?

I believe the original 3 hits are: Homo sapiens tumor necrosis factor, superfamily, member 10 transcript variant 4, 2, and 1, respectively: NR_033994.1, NM_001190942.1, NM_003810.3. I used the default settings, which included Human genomic + transcript, but I optimized for somewhat similar sequence. 

You are not suppose to get the original hits b/c of the mismatch and the fact that the default word size is 11. 

- The first PCR primer shows a mismatch between A and T. I used somewhat similar sequences and the short queries box to automatically adjust parameters for short input sequences was checked. The previous hits are missing. The reason that the previous hits are missing is due to the fact that the word size is set to 11, which means there needs to be an exact match of 11 before extending to the next 11 nucleotides. Since the mismatch is in the middle there will be no word hits. You would need to adjust the word size to 7.  

Request for Solution File

Ask an Expert for Answer!!
Basic Computer Science: The first pcr primer shows a mismatch
Reference No:- TGS097202

Expected delivery within 24 Hours