--%>

Single substitution polymorphism


Discussion:

Single Substitution Polymorphism

1.5'tggtggtggaggctggggtcaaggtggtagccacagtcagtggaacaagcccagtaagccaaaaccaacaygaagcatgtggcaggagctgctgcagctggagcagtggtagggggccttggtggctacat3'

2. Can this sequence be cut by a restriction enzyme?

3. Can the fragments and coupled with electrophoresis be used to find a single substitution polymorphism?

Write your answer/response in detail with examples and facts and figures using APA style of formatting, size 12, font Times new roman and answer must be single spaced

Solution Preview :

Prepared by a verified Expert
Biology: Single substitution polymorphism
Reference No:- TGS01911463

Now Priced at $20 (50% Discount)

Recommended (91%)

Rated (4.3/5)