--%>

Sequence 1 and sequence 2 are short sequences of dna with a


Sequence 1 and sequence 2 are short sequences of DNA with a message. To decipher the message, you will need to first transcribe and then translate the sequences. Using the single letter code of each amino acid obtained upon translating the sequence, crack the message contained. Please note that there are only 20 amino acids. Therefore, you may need to insert any/all of the letters B, J, O, U, X, Z to complete the message.

DNA Sequence 1: 3'- CGGGGGCGGTAG

TCCTCAACCTAGTGGGTGTGG - 5'

DNA Sequence 2: 3'- AGGACGTA

GCTTTTAACGCTCTAAAGGAAATTA- 5'

Solution Preview :

Prepared by a verified Expert
Biology: Sequence 1 and sequence 2 are short sequences of dna with a
Reference No:- TGS02810978

Now Priced at $10 (50% Discount)

Recommended (96%)

Rated (4.8/5)