Nucleotide sequence of the template strand


A scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3'gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5'

(a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene.

(b) write down the mrna produces from this gene.

(c) how many amino acids will be present in the protein product of this gene.

(d) write amino acid sequence of the polypeptide

Request for Solution File

Ask an Expert for Answer!!
Biology: Nucleotide sequence of the template strand
Reference No:- TGS0523659

Expected delivery within 24 Hours