Discussion:
Sequencing of DNA or RNA
Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:
1) Is this a strand of DNA or RNA? How do you know?
2) If DNA, what is the complementary strand?
3) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
4) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
5) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
6) What would happen to the reading frame if three bases were inserted/deleted? Why?