If dna-what is the complementary strand


Discussion:

Sequencing of DNA or RNA

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

1) Is this a strand of DNA or RNA? How do you know?

2) If DNA, what is the complementary strand?

3) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

4) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

5) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

6) What would happen to the reading frame if three bases were inserted/deleted? Why?

Solution Preview :

Prepared by a verified Expert
Biology: If dna-what is the complementary strand
Reference No:- TGS01911047

Now Priced at $20 (50% Discount)

Recommended (95%)

Rated (4.7/5)