Assignment
1. During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of E. coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?
2. Does RNA polymerase holoenzyme recognize the sense, or antisense strand? The antisense strand is used for what purpose during transcription?
3. A single strand of bacterial DNA contains the base sequence
-35 -10 +1
5' CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3'
a. What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.
b. Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.
c. Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.
4. If a stop codon is not included in the mRNA molecule, how would this affect the following:
a. translocation on the mRNA by polyribosomes
b. concentration of this specific polypeptide in the cell
5. How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?
Attachment:- Bacterial-DNA.rar