How does rna differ from dna


Assignment:

1. Chemically, how does RNA differ from DNA?

2. What are the base pairing rules for making an mRNA transcript of a DNA gene?

3. Here is part of a gene:

GTAACCGTATTGCAGCTATTAGCAGCCATG

CATTGGCATAACGTCGATAATCGTCGGTAC

If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from this section of the gene.

4. Which strand (top or bottom) would the promoter be found on? Why?

5. mRNA is divided into three base sections called codons. Divide the mRNA that you wrote in question 3 into its 10 codons.

6. Explain how mRNA and tRNA work together to get amino acids into their correct places in the protein.

7. Using the genetic code table, determine which amino acids would go into this part of the protein.

8. In a frameshift mutation, one or more nucleotide bases of the DNA is accidentally lost or added. If a frameshift mutation occurred that caused the second Tin the coding DNA strand above to be lost, what would the new coding DNA strand and the new mRNA codons be?

DNA:

RNA:

9. Which amino acids would be found in the mutated protein?

10. The effects of frameshift mutations range from severe disruption of the protein to having essentially no effect at all. What effect do you think this mutation would have on the functioning of the protein? What do you think determines the severity of the effect of a frameshift mutation on the protein?

Solution Preview :

Prepared by a verified Expert
Biology: How does rna differ from dna
Reference No:- TGS03155940

Now Priced at $30 (50% Discount)

Recommended (98%)

Rated (4.3/5)