Find out the percentage inside the s sequence, Programming Languages

+44 141 628 6080
[email protected]

Find out the percentage inside the s sequence

Problem

Find the percentage for all the dinucleotide and trinucleotide combinations for the sequence: S="TACGTGCGCGCGAGCTATCTACTGACTTACGACTAGTGTAGCTGCATCATCGATCGA".

• Build a brute force engine to generate all dinucleotide and trinucleotide combinations.
• For each combination, find out the percentage inside the S sequence.
• Show the percentage for each combination in the output of your implementation.

The code can be implemented in C++/Java/Python.

View Complete Question

Request for Solution File

Ask an Expert for Answer!!

Programming Languages: Find out the percentage inside the s sequence

Reference No:- TGS03257027

Expected delivery within 24 Hours

Have a Question? (oR Write a Review)

Write atleast 100 words!!

Asked Questions

What are the calculated rbc indices

A patient has a RBC count of 4.7 X 1012/L, hemoglobin of 110 g/L (11.0 g/dL), and hematocrit of 35.0%. What are the calculated RBC indices

Male who is developing an acute myocardial infarction

A 53-year-old male who is developing an acute myocardial infarction from coronary occlusion has an irreversible injury to the myocardium when

Discuss -healthcare staff and patients in a hospital setting

The impact of mechanical devices for lifting and transferring of patients on low back pain and musculoskeletal injuries in health care personnel-A systematic

Discussion about female who had a cerebral infarction

A 59-year-old female had a cerebral infarction. Months later, a computed tomographic (CT) scan shows a cystic area filled with clear yellow fluid

Provide a brief description of the patient care technology

Introduction: Provide a brief description of the patient care technology/system you have chosen.

How soap note captures several important elements of ty case

Problem: The SOAP note captures several important elements of Ty's case but also leaves room for improvement.

Problem about post-emergency open fracture femur reduction

A 14-year-old, 18 hours post-emergency open fracture femur reduction is observed crying as the bedside shift report is being conducted

Request for Solution File

Ask an Expert for Answer!!

Programming Languages: Find out the percentage inside the s sequence

Reference No:- TGS03257027

Have a Question? (oR Write a Review)

Recent Questions Asked Programming Languages

Q : Write a c program with the required number of pipe

Q : Describe how you determined your logical flow for script

Q : What are ways you can protect your password

Q : What type of computer network would the city most likely use

Q : Find out the percentage inside the s sequence

Q : Create a table with subnets netid host range and broadcastid

Q : Explain with illustrations how the operations can be perform

Q : Identify the most suitable data structure to be used

Q : Write a program that counts the number of unique words