--%>

Determine how many times a occurs in the dna string create


Question :

Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T.

Write a program that does the following: Create a random DNA string of length 50.

Determine how many times A occurs in the DNA string. Create a dot string which blanks out everything but all the A characters.

Create a rep string where everything is blanked out except where A repeats 1 or more times. Prints the results as follows:

DNA: TGAAAACTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA

dotStr:.. AAAA. .A..A.A. .A...A...... AAA.AA.AAA.....A..A.AAA

repStr:. AAAA.....................AAA.AA.AAA.........AAA

#A: 22

Request for Solution File

Ask an Expert for Answer!!
Computer Engineering: Determine how many times a occurs in the dna string create
Reference No:- TGS02935491

Expected delivery within 24 Hours