--%>

Describe the beta chain of hemoglobin of human gene


Problem:

In the human gene for the beta chain of hemoglobin, the oxygen-carrying protein in the red blood cells, the first 30 nucleotides in the protein-coding region are shown here: 3' TACCACGTGGACTGAGGACTCCTCTTCAGA 5'

Required:

Question 1: What is the sequence of the partner strand?

Question 2: If the DNA duplex of this gene were transcribed from left to right, what is the base sequence of the RNA across this part of the coding region?

Question 3: What is the sequence of amino acids in this part of the beta-globin polypeptide chain?

Request for Solution File

Ask an Expert for Answer!!
Biology: Describe the beta chain of hemoglobin of human gene
Reference No:- TGS0879581

Expected delivery within 24 Hours