A what isare the lengths of the newly synthesized strands


This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:dideoxy); the DNA is danatured, danaturant is removed and primer is annealed, and DNA polymerase is added.

a) What is/are the length(s) of the newly synthesized strand(s) in bases?

b) What is/are the length(s) of the newly synthesized strand(s) in bases if ddATP is excluded?

Please explain the process.

Solution Preview :

Prepared by a verified Expert
Dissertation: A what isare the lengths of the newly synthesized strands
Reference No:- TGS02916503

Now Priced at $10 (50% Discount)

Recommended (91%)

Rated (4.3/5)